U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

SRX19667551: Amplicon sequencing of ITS2: Veronica montana
1 ILLUMINA (Illumina NovaSeq 6000) run: 87,383 spots, 43.7M bases, 12.1Mb downloads

Design: Target ITS2 region was amplified using ITS3 (5 GCATCGATGAAGAACGCAGC 3) and ITS4 (5 TCCTCCGCTTATTGATATGC 3) primers. Library preparartion was outsourced to Novogene and sequenced using PE250 strategy.
Submitted by: University of Split
Study: Croatian Veronica species: Phytotaxonomy and Biological Activity
PRJNA944611 • SRP427195 • All experiments • All runs
show Abstracthide Abstract
CROVeS-PhyBA focuses on the isolations, identification, distribution, phytotaxonomic affiliation and biological activity of specialized metabolites among selected Croatian species genus Veronica (Plantaginaceae family).
Sample:
SAMN33750265 • SRS17037825 • All experiments • All runs
Organism: Veronica montana
Library:
Name: N_14_2_ITS2
Instrument: Illumina NovaSeq 6000
Strategy: AMPLICON
Source: GENOMIC
Selection: PCR
Layout: PAIRED
Runs: 1 run, 87,383 spots, 43.7M bases, 12.1Mb
Run# of Spots# of BasesSizePublished
SRR2385490587,38343.7M12.1Mb2024-03-01

ID:
26974914

Supplemental Content

Related information

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...